ChangeLog

Jan 18, 2024, Version 2.75 - tusi

Maximum number of primer mathches was increased to 200000.

Jan 18, 2024, Version 2.74 - tusi

Database update, following the Ensembl 111 release.

Feb 10, 2023, Version 2.73 - tusi

Database update, following the Ensembl 109 release.

Oct 21, 2022, Version 2.72 - tusi

Database update, following the Ensembl 108 release.

Jul 16, 2022, Version 2.71 - tusi

Database update, following the Ensembl 107 release.

Apr 14, 2022, Version 2.70 - tusi

Database update, following the Ensembl 106 release.

Dec 01, 2020, Version 2.69 - tusi

Database update, following the Ensembl 102 release.

May 01, 2020, Version 2.68 - tusi

Database update, following the Ensembl 100 release.

Mar 13, 2020, Version 2.67 - tusi

New genome sequences of fruit fly (Drosophila melanogaster) have been been indexed and are available for ePCR.

Jan 17, 2020, Version 2.66 - tusi

Database update, following the Ensembl 99 release.

Oct 12, 2019, Version 2.65 - tusi

Database update, following the Ensembl 98 release.

Jul 10, 2019, Version 2.64 - tusi

Database update, following the Ensembl 97 release.

Apr 15, 2019, Version 2.63 - tusi

Database update, following the Ensembl 96 release.

Jan 14, 2019, Version 2.62 - tusi

Database update, following the Ensembl 95 release.

Sep 27, 2018, Version 2.61 - tusi

Genom sequence of Xenopus laevis has been indexed and is available for ePCR.

Apr 09, 2018, Version 2.60 - tusi

Database update, following the Ensembl 92 release.

Dec 14, 2017, Version 2.59 - tusi

Database update, following the Ensembl 91 release.

Sep 06, 2017, Version 2.58 - tusi

New cDNA and genome sequences of golden hamster (Mesocricetus auratus) have been been indexed and are available for ePCR.

Jun 02, 2017, Version 2.57 - tusi

Database update, following the Ensembl 89 release.

May 19, 2017, Version 2.56 - tusi

Bug fixing. Serious memory leak in the code. Thanks for reporting this bug to Alexander Koch (a dot koch at maastrichtuniversity dot nl).

May 16, 2017, Version 2.55 - tusi

New cDNA sequence of feline (Felis catus) has been been indexed and is available for ePCR.

Mar 31, 2017, Version 2.54 - tusi

Database update, following the Ensembl 88 release.

Oct 08, 2016, Version 2.53 - tusi

Database update, following the Ensembl 86 release.

Jul 21, 2016, Version 2.52 - tusi

Database update, following the Ensembl 85 release.

Mar 17, 2016, Version 2.51 - tusi

Database update, following the Ensembl 84 release.

Dec 10, 2015, Version 2.50 - tusi

Database update, following the Ensembl 83 release.

Oct 01, 2015, Version 2.49 - tusi

Database update, following the Ensembl 82 release.

Jul 21, 2015, Version 2.48 - tusi

Database update, following the Ensembl 81 release.

May 26, 2015, Version 2.47 - tusi

Database update, following the Ensembl 80 release.

May 11, 2015, Version 2.46 - tusi

New cDNA sequence of horse (Equus caballus) has been been indexed and is available for ePCR.

Mar 16, 2015, Version 2.45 - tusi

Database update, following the Ensembl 79 release.

Mar 06, 2015, Version 2.44 - tusi

New cDNA sequence of dog (Canis familiaris) has been been indexed and is available for ePCR.

Jan 08, 2015, Version 2.43 - tusi

The BiSearch web server moved to a newly build server, containing two 2Tb Intel SSD (Intel SSD DC P3600 Series), connected via software raid0. According to our benchmark test, the new server is approx 5 times faster, than the previous was.

Dec 05, 2014, Version 2.42 - tusi

Database update, following the Ensembl 78 release.

Aug 15, 2014, Version 2.41 - tusi

Database update, following the Ensembl 76 release.

Mar 25, 2014, Version 2.40 - tusi

New cDNA sequence of pig (Sus scrofa) has been been indexed and is available for ePCR.

Mar 02, 2014, Version 2.39 - tusi

Database update, following the Ensembl 75 release.

Feb 20, 2014, Version 2.38 - tusi

New genome sequences of bovin (Bos taurus), pig (Sus scrofa), horse (Equus caballus) and sheep (Ovis aries) have been indexed and are available for ePCR.

Dec 12, 2013, Version 2.37 - tusi

Database update, following the Ensembl 74 release.

Sep 08, 2013, Version 2.36 - tusi

Database update, following the Ensembl 73 release.

Jun 21, 2013, Version 2.35 - tusi

Database update, following the Ensembl 72 release.

Apr 17, 2013, Version 2.34 - tusi

Database update, following the Ensembl 71 release.

Jan 20, 2013, Version 2.33 - tusi

Database update, following the Ensembl 70 release.

Oct 27, 2012, Version 2.32 - tusi

Database update, following the Ensembl 69 release.

Aug 12, 2012, Version 2.31 - tusi

Database update, following the Ensembl 68 release.

May 14, 2012, Version 2.30 - tusi

New genome sequences for Caenorhabditis elegans have been added.

May 14, 2012, Version 2.29 - tusi

Database update, following the Ensembl 67 release.

Mar 08, 2012, Version 2.28 - tusi

Database update, following the Ensembl 66 release.

Feb 23, 2012, Version 2.27 - tusi

New cDNA sequences for Gallus gallus have been added.

Dec 15, 2011, Version 2.26 - tusi

Database update, following the Ensembl 65 release.

Sep 21, 2011, Version 2.25 - tusi

Database update, following the Ensembl 64 release.

Aug 29, 2011, Version 2.24 - tusi

New genome sequences for Gallus gallus have been added.

Jul 19, 2011, Version 2.23 - tusi

Database update, following the Ensembl 63 release.

Apr 20, 2011, Version 2.22 - tusi

Database update, following the Ensembl 62 release.

Feb 05, 2011, Version 2.21 - tusi

Database update, following the Ensembl 61 release.

Nov 12, 2010, Version 2.20 - tusi

Database update, following the Ensembl 60 release.

Mar 17, 2010, Version 2.19 - tusi

Database update, following the Ensembl 57 release.

Oct 02, 2009, Version 2.18 - tusi

Database update, following the Ensembl 56 release.

Aug 31, 2009, Version 2.17 - tusi

New genome and cDNA sequences for Saccharomyces cerevisiae have been added.

Aug 17, 2009, Version 2.16 - tusi

Bug fixing. Primer pair annealings were incorrectly reported. Thanks for reporting this bug to Roland Thunauer (roland dot thunauer at uar dot at).

Jul 17, 2009, Version 2.15 - tusi

Database update, following the Ensembl 55 release.

May 13, 2009, Version 2.14 - tusi

Database update, following the Ensembl 54 release.

Nov 24, 2008, Version 2.13 - tusi

Database update, following the Ensembl 51 release.

Oct 08, 2008, Version 2.12 - tusi

New genome, Canis familiaris has been added.

Apr 08, 2008, Version 2.11 - tusi

New genome, Danio rerio has been added.

Apr 08, 2008, Version 2.10 - tusi

The newly installed machine capacity allowed us to develop simple search and methylation sensitive primer search and ePCR options. These search options are running on virtual bisulfite treated completely methylated genomes (i.e. all non-CpG cytosines are converted to thymines, while CpG cytosines remain unconverted).

Apr 06, 2008, Version 2.09 - tusi

A new system was installed to automatically download and index new Ensembl releases. A new computer with four CPUs, 2Tb winchester capacity and 8Gb memory was installed. This highly accelerates computing times and enables us to index new genomes if required.

Feb 04, 2008, Version 2.08 - tusi

A new menu point, "Genome builds" has been added to help to find information about what version of the genome builds or database are used by the BiSearch Web Server.

Feb 01, 2008, Version 2.07 - tusi

Preprocessing of the input primer for genome search has been modified. Previously the input primers were bisulfite treated by the software before the search on the bisulfite treated genome if the primers were not designed for the amplification of the sense strand. This modification step has been removed from the software.

Jun 16, 2006, Version 2.06 - tusi

Multiple primer pairs can be submitted for ePCR in one file. Each line in the uploaded file should contain a primer pair preceeded by an ID. Primer sequences should be separated by space.

Example:

	name_1 ACGTAGCGATGGCAGATAGCA GTGCAGAGTGGAGCCGGAA
	name_2 ACTTCGACAATCAGGTCA TACGATAGCGCATCCAGAT
	name_3 TGACGATGGCACATCATTC TGCATGCAGGACTCCAAAT

May 03, 2006, Version 2.05 - tusi

Database update:

Homo sapiens: NCBI 36

Apr 28, 2006, Version 2.04 - tusi

Index files for various cDNA libraries were added. They are:

Bos taurus (Btau 2.0)
Caenorhabditis elegans (WS 150)
Danio rerio (ZFISH5)
Drosophila melanogaster (BDGP4.2)
Homo sapiens (NCBI 36)
Mus musculus (NCBI m35)
Pan troglodytes (PanTro 1.0)
Rattus norvegicus (RGSC 3.4)

Links to the corresponding Ensembl transcript are available on the result pages.

Mar 06, 2006, Version 2.03 - tusi

Bug fixing. Position of PCR 3' end was reported with error (the length of right primer was twice added). Thanks for reporting this bug to C Rohde (chr.rohde at web dot de).

Mar 06, 2006, Version 2.02 - tusi

Bug fixing. There was an endless loop in case of simple genome search did not result in any match.

Jan 31, 2006, Version 2.01 - tusi

Databases for the four genomes have been installed. Versions are:

Homo sapiens: NCBI 35
Mus musculus: NCBI m34
Rattus norvegicus: RGSC 3.4
Pan troglodytes: PanTro 1.0

Jan, 2006, Version 2.0 - tusi

BiSearch Web Server has been redesigned. All codes and pages were rewritten. The new fpcr algorithm was included in the server. Therefore no need to store and e-mail genome search results to users. This new feature led to us to free the server from registration. Academic users are allowed to use the server free and without registration. The newly designed server has a lot of new features:

Parameters are stored by the user's web browser, using cookies;
Parameters are grouped for the various tasks, therefore users can easily find and edit them;
Parameters can be shown for each separate tasks, either for set them before calculation/searching or after it in the result page;
A new online help system was integrated to the server to help users to fill in the various input forms;
Result's page of primer design are brushed up by some javascript codes showing the vaious primer's annealings and PCR products in a tooltip window, while the mouse is over the result table cells;
After primer design, primer genome search can be done only separately.
The greatest achivement on the server is the integration of FPCR algorithm into the genome search. FPCR (Fast PCR) algorithm uses constant 16mer oligonucleotides for searching. The search is done by applying hash matrices. A typical search is done within one minute (for comparison: by using the old search algorithm a typical bisulfite prepared primer genome search was taken about 20 minutes).

Dec 05, 2005, Version 1.99 - tusi

A very fast pcr algorithm was coded. Fixed 16mer oligonucleotid sequences can be searched in the genome. We need some fast and large winchester to use this new fpcr algorithm.

Feb 21, 2005, Version 1.0.5 - tusi

BiSearch Web Server has been moved to a new machine, which is 1.5 times faster than previous one.

Jan 22, 2005, Version 1.0.4 - tusi

Commercial users are allowed to use the server in a test mode. That is they are allowed to run the Primer Design on bisulfite treated sample tools five times, and five times the Genome Search tool either with their own primers or with primer designed by the server. Commercial users may allowed to use the other tools on this server unlimitedly.

Commercial users can apply the test LICENSE AGREEMENT by using this link.

A new logo was added to the server.

Dec 14, 2004, Version 1.0.3 - tusi

New feature: default parameter set can be restored by clicking "Get Default Values" on the Set parameters page.

Default value of minimum primer length was increased to 20.

Primer search range is set to 0-n/2 and n/2-n for forward and reverse primer, respectively, where n is the length of the sequence.

New feature: user can select between "specific" and "more specific" primer design parameters in the case of MSP, where "specific" means that only one of the two primers has CpG site it's 3' end, while "more specific" means that both primers have to be CpG site their 3' end.

If more than 10000 hit is found during the primer genome search, only the number of hits is written to the output, rather than enumerating each hits.

Nov 29, 2004, Version 1.0.2 - tusi

User login system changed. Now, users may store they data on the BiSearch Web Server for a week. They can reread their former results file. After finishing genome search BiSearch Web Server send only a notification to the user instead of sending the whole results, which can be some tens megabyte.

File changed: login.php, index.php

Nov 28, 2004, Version 1.0.1 - tusi

ChangeLog system is started.

File changed: index.php, changelog.php

Nov 1, 2004, Version 1.0.0 - tusi

BiSearch Web Server is launched.

File changed: all files under the BiSearch Web Server.

Menu

Help

Statistics

ChangeLog